anti hs Search Results


94
Chem Impex International vwr extra pure
Vwr Extra Pure, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vwr extra pure/product/Chem Impex International
Average 94 stars, based on 1 article reviews
vwr extra pure - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

96
Proteintech ptgs2
Fig. 3. Alpha-tocopherol alleviates ferroptosis after SCI. (A-B) Prussian Blue Iron Staining (Enhance With DAB) and quantitation. The positive stained tissue was observed in SCI group. The positive cells (iron overloaded cells) were colored by yellow-brown, the negative cells (normal cells) were colored by purple or blue. (C-F) WB and quantitation of Alox15, <t>Ptgs2</t> and 4Hne in vivo. (G-J) IF and quantitation of Alox15 and Ptgs2. NeuN was colored by red, Alox15 and Ptgs2 were colored by green. n = 5 for each group. Data are represented as the means ± SD. ***p < 0.001.
Ptgs2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ptgs2/product/Proteintech
Average 96 stars, based on 1 article reviews
ptgs2 - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

93
Proteintech tradd
Fig. 3. Alpha-tocopherol alleviates ferroptosis after SCI. (A-B) Prussian Blue Iron Staining (Enhance With DAB) and quantitation. The positive stained tissue was observed in SCI group. The positive cells (iron overloaded cells) were colored by yellow-brown, the negative cells (normal cells) were colored by purple or blue. (C-F) WB and quantitation of Alox15, <t>Ptgs2</t> and 4Hne in vivo. (G-J) IF and quantitation of Alox15 and Ptgs2. NeuN was colored by red, Alox15 and Ptgs2 were colored by green. n = 5 for each group. Data are represented as the means ± SD. ***p < 0.001.
Tradd, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tradd/product/Proteintech
Average 93 stars, based on 1 article reviews
tradd - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Proteintech 13839 1 ap
Fig. 3. Alpha-tocopherol alleviates ferroptosis after SCI. (A-B) Prussian Blue Iron Staining (Enhance With DAB) and quantitation. The positive stained tissue was observed in SCI group. The positive cells (iron overloaded cells) were colored by yellow-brown, the negative cells (normal cells) were colored by purple or blue. (C-F) WB and quantitation of Alox15, <t>Ptgs2</t> and 4Hne in vivo. (G-J) IF and quantitation of Alox15 and Ptgs2. NeuN was colored by red, Alox15 and Ptgs2 were colored by green. n = 5 for each group. Data are represented as the means ± SD. ***p < 0.001.
13839 1 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/13839 1 ap/product/Proteintech
Average 93 stars, based on 1 article reviews
13839 1 ap - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Proteintech ikzf1 k164la ptm
Fig. 5. Hyperlactylation of <t>Ikzf1</t> at Lys164 is important for TH17 differentiation. (A) Radar diagram showing the top 15 DLPs in CD4+ T cells of EAU mice. (B) Enriched GO biological processes of up-regulated Kla proteins. (C and D) MS/MS spectra of the lactylated peptides of Ikzf1 at Lys164 and Lys373. (E) Immunoblot after immuno- precipitation (IP) assays showing increased lactylation of Ikzf1 in CD4+ T cells of EAU mice (n = 4 samples per group; **P < 0.01 by two-tailed unpaired Student’s t test). (F) Expression of Ikzf1 in CD4+ T cells of TH0 and TH17 groups measured through Western blotting (n = 4 samples per group; ns, no significance by two-tailed unpaired Student’s t test). (G) CD4+ T cells were transfected with the control virus (control), only sh-Ikzf1 (sh-Ikzf1), shIkzf1+oeWT-Ikzf1 (oeWT-Ikzf1), shIkzf1+oeK164R Ikzf1 (oeK164R-Ikzf1), and shIkzf1+oe K373R Ikzf1 (oeK373R-Ikzf1) adenovirus. Expression levels of Ikzf1 in different groups were measured through Western blotting (n = 4 samples per group; ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (H) FCM analysis of the frequency of TH17 cells in different groups as described in (G) (n = 4 samples per group; ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (I) Expression levels of IL-17 in the media of corresponding groups were tested by ELISA (n = 8 samples per group; **P < 0.01 and ***P < 0.001 by Kruskal-Wallis test). m/z, mass/charge ratio.
Ikzf1 K164la Ptm, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ikzf1 k164la ptm/product/Proteintech
Average 93 stars, based on 1 article reviews
ikzf1 k164la ptm - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

95
Proteintech 11739 1 ap
Fig. 5. Hyperlactylation of <t>Ikzf1</t> at Lys164 is important for TH17 differentiation. (A) Radar diagram showing the top 15 DLPs in CD4+ T cells of EAU mice. (B) Enriched GO biological processes of up-regulated Kla proteins. (C and D) MS/MS spectra of the lactylated peptides of Ikzf1 at Lys164 and Lys373. (E) Immunoblot after immuno- precipitation (IP) assays showing increased lactylation of Ikzf1 in CD4+ T cells of EAU mice (n = 4 samples per group; **P < 0.01 by two-tailed unpaired Student’s t test). (F) Expression of Ikzf1 in CD4+ T cells of TH0 and TH17 groups measured through Western blotting (n = 4 samples per group; ns, no significance by two-tailed unpaired Student’s t test). (G) CD4+ T cells were transfected with the control virus (control), only sh-Ikzf1 (sh-Ikzf1), shIkzf1+oeWT-Ikzf1 (oeWT-Ikzf1), shIkzf1+oeK164R Ikzf1 (oeK164R-Ikzf1), and shIkzf1+oe K373R Ikzf1 (oeK373R-Ikzf1) adenovirus. Expression levels of Ikzf1 in different groups were measured through Western blotting (n = 4 samples per group; ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (H) FCM analysis of the frequency of TH17 cells in different groups as described in (G) (n = 4 samples per group; ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (I) Expression levels of IL-17 in the media of corresponding groups were tested by ELISA (n = 8 samples per group; **P < 0.01 and ***P < 0.001 by Kruskal-Wallis test). m/z, mass/charge ratio.
11739 1 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/11739 1 ap/product/Proteintech
Average 95 stars, based on 1 article reviews
11739 1 ap - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

93
Proteintech cldn7
A Immunohistochemical staining of CD45 expression in colon lesions of Apc −/− versus Apc −/− ;Pkd1 −/− mice. Left—representative images, scale bars, 200 μm. Right—quantification. B Quantification of FITC-dextran levels in serum of dextran sodium sulfate (DSS)- or control water (Ctrl)-treated mice. C Representative H&E images of colon tissue from Pkd1 wt versus Pkd1 −/− mice treated with water or DSS. Scale bars, 100 μm. Measurements of mouse weight during treatment are located in Fig . D , E Representative images (left) and quantification (right) of expression of CLDN4 ( D ) and <t>CLDN7</t> ( E ) in wt versus Pkd1 −/− colon epithelia. Scale bars 50 μm. F , G Representative images (left) and quantification (right) of CLDN4 and CLDN7 staining in organoids. Blue, DAPI; green, claudins. Scale bars 50 μm. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001 for all graphs.
Cldn7, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cldn7/product/Proteintech
Average 93 stars, based on 1 article reviews
cldn7 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Proteintech agaacgaccaccatcaactc asgr2
A Immunohistochemical staining of CD45 expression in colon lesions of Apc −/− versus Apc −/− ;Pkd1 −/− mice. Left—representative images, scale bars, 200 μm. Right—quantification. B Quantification of FITC-dextran levels in serum of dextran sodium sulfate (DSS)- or control water (Ctrl)-treated mice. C Representative H&E images of colon tissue from Pkd1 wt versus Pkd1 −/− mice treated with water or DSS. Scale bars, 100 μm. Measurements of mouse weight during treatment are located in Fig . D , E Representative images (left) and quantification (right) of expression of CLDN4 ( D ) and <t>CLDN7</t> ( E ) in wt versus Pkd1 −/− colon epithelia. Scale bars 50 μm. F , G Representative images (left) and quantification (right) of CLDN4 and CLDN7 staining in organoids. Blue, DAPI; green, claudins. Scale bars 50 μm. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001 for all graphs.
Agaacgaccaccatcaactc Asgr2, supplied by Proteintech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/agaacgaccaccatcaactc asgr2/product/Proteintech
Average 90 stars, based on 1 article reviews
agaacgaccaccatcaactc asgr2 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

94
Proteintech gipc1 immunostaining
(A) The CGG repeat is located within exon 1 of <t>GIPC1</t> . Primers and probes for repeat-primed PCR (RP-PCR, green), fragment analysis (blue), and RNA fluorescence in situ hybridization (FISH, red) were designed within or adjacent to the repeat region. (B) The left panel shows the results for RP-PCR, in which abnormal CGG repeat expansions were detected in the upper three cases. The middle panel displays the results of fragment analysis. The right panel presents histograms of repeat sizes estimated from long-read sequencing data using NanoRepeat; orange bars indicate expanded alleles. (C) Histogram of CGG repeat sizes determined through fragment analysis. The lower graph shows an enlarged view of the low-frequency range. In the control group, most alleles contained 32 or fewer repeats. Two control samples exhibited abnormally expanded alleles, whereas four ALS samples harbored alleles with 33 or more repeats.
Gipc1 Immunostaining, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gipc1 immunostaining/product/Proteintech
Average 94 stars, based on 1 article reviews
gipc1 immunostaining - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

90
ProSci Incorporated claudin 1
(A) The CGG repeat is located within exon 1 of <t>GIPC1</t> . Primers and probes for repeat-primed PCR (RP-PCR, green), fragment analysis (blue), and RNA fluorescence in situ hybridization (FISH, red) were designed within or adjacent to the repeat region. (B) The left panel shows the results for RP-PCR, in which abnormal CGG repeat expansions were detected in the upper three cases. The middle panel displays the results of fragment analysis. The right panel presents histograms of repeat sizes estimated from long-read sequencing data using NanoRepeat; orange bars indicate expanded alleles. (C) Histogram of CGG repeat sizes determined through fragment analysis. The lower graph shows an enlarged view of the low-frequency range. In the control group, most alleles contained 32 or fewer repeats. Two control samples exhibited abnormally expanded alleles, whereas four ALS samples harbored alleles with 33 or more repeats.
Claudin 1, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/claudin 1/product/ProSci Incorporated
Average 90 stars, based on 1 article reviews
claudin 1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Proteintech rabbit monoclonal antibody
(A) The CGG repeat is located within exon 1 of <t>GIPC1</t> . Primers and probes for repeat-primed PCR (RP-PCR, green), fragment analysis (blue), and RNA fluorescence in situ hybridization (FISH, red) were designed within or adjacent to the repeat region. (B) The left panel shows the results for RP-PCR, in which abnormal CGG repeat expansions were detected in the upper three cases. The middle panel displays the results of fragment analysis. The right panel presents histograms of repeat sizes estimated from long-read sequencing data using NanoRepeat; orange bars indicate expanded alleles. (C) Histogram of CGG repeat sizes determined through fragment analysis. The lower graph shows an enlarged view of the low-frequency range. In the control group, most alleles contained 32 or fewer repeats. Two control samples exhibited abnormally expanded alleles, whereas four ALS samples harbored alleles with 33 or more repeats.
Rabbit Monoclonal Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit monoclonal antibody/product/Proteintech
Average 93 stars, based on 1 article reviews
rabbit monoclonal antibody - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Proteintech fetuin a
(A) The CGG repeat is located within exon 1 of <t>GIPC1</t> . Primers and probes for repeat-primed PCR (RP-PCR, green), fragment analysis (blue), and RNA fluorescence in situ hybridization (FISH, red) were designed within or adjacent to the repeat region. (B) The left panel shows the results for RP-PCR, in which abnormal CGG repeat expansions were detected in the upper three cases. The middle panel displays the results of fragment analysis. The right panel presents histograms of repeat sizes estimated from long-read sequencing data using NanoRepeat; orange bars indicate expanded alleles. (C) Histogram of CGG repeat sizes determined through fragment analysis. The lower graph shows an enlarged view of the low-frequency range. In the control group, most alleles contained 32 or fewer repeats. Two control samples exhibited abnormally expanded alleles, whereas four ALS samples harbored alleles with 33 or more repeats.
Fetuin A, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fetuin a/product/Proteintech
Average 93 stars, based on 1 article reviews
fetuin a - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


Fig. 3. Alpha-tocopherol alleviates ferroptosis after SCI. (A-B) Prussian Blue Iron Staining (Enhance With DAB) and quantitation. The positive stained tissue was observed in SCI group. The positive cells (iron overloaded cells) were colored by yellow-brown, the negative cells (normal cells) were colored by purple or blue. (C-F) WB and quantitation of Alox15, Ptgs2 and 4Hne in vivo. (G-J) IF and quantitation of Alox15 and Ptgs2. NeuN was colored by red, Alox15 and Ptgs2 were colored by green. n = 5 for each group. Data are represented as the means ± SD. ***p < 0.001.

Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie

Article Title: Alpha-tocopherol inhibits ferroptosis and promotes neural function recovery in rats with spinal cord injury via downregulating Alox15.

doi: 10.1016/j.biopha.2024.116734

Figure Lengend Snippet: Fig. 3. Alpha-tocopherol alleviates ferroptosis after SCI. (A-B) Prussian Blue Iron Staining (Enhance With DAB) and quantitation. The positive stained tissue was observed in SCI group. The positive cells (iron overloaded cells) were colored by yellow-brown, the negative cells (normal cells) were colored by purple or blue. (C-F) WB and quantitation of Alox15, Ptgs2 and 4Hne in vivo. (G-J) IF and quantitation of Alox15 and Ptgs2. NeuN was colored by red, Alox15 and Ptgs2 were colored by green. n = 5 for each group. Data are represented as the means ± SD. ***p < 0.001.

Article Snippet: Slices were incubated overnight at 4°C with the primary antibodies against Alox15 (rabbit, 1:200, Affinity, Cat# DF13494, RRID: AB_2846513), Ptgs2 (rabbit, 1:200, Affinity, Cat# AF7003, RRID: AB_2835311), Gapdh (mouse, 1:200, Proteintech, Wuhan, China, Cat# 60004–1-Ig, RRID: AB_2107436) and neuronal nuclei (NeuN, mouse, 1:200, Proteintech, Cat# 66836–1-Ig, RRID: AB_2882179).

Techniques: Staining, Quantitation Assay, In Vivo

Fig. 6. Alpha-tocopherol downregulates expression of Alox15 and Ptgs2 in PC12 cells. (A-B) QPCR for mRNA of Alox15 and Ptgs2. (C-F) WB and quantitation of Alox15, Ptgs2 and 4Hne in vitro. (G-J) IF and quantitation of Alox15 and Ptgs2. Alox15 and Ptgs2 were colored by green. n = 3 for each group. Data are represented as the means ± SD. **p < 0.01, ***p < 0.001.

Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie

Article Title: Alpha-tocopherol inhibits ferroptosis and promotes neural function recovery in rats with spinal cord injury via downregulating Alox15.

doi: 10.1016/j.biopha.2024.116734

Figure Lengend Snippet: Fig. 6. Alpha-tocopherol downregulates expression of Alox15 and Ptgs2 in PC12 cells. (A-B) QPCR for mRNA of Alox15 and Ptgs2. (C-F) WB and quantitation of Alox15, Ptgs2 and 4Hne in vitro. (G-J) IF and quantitation of Alox15 and Ptgs2. Alox15 and Ptgs2 were colored by green. n = 3 for each group. Data are represented as the means ± SD. **p < 0.01, ***p < 0.001.

Article Snippet: Slices were incubated overnight at 4°C with the primary antibodies against Alox15 (rabbit, 1:200, Affinity, Cat# DF13494, RRID: AB_2846513), Ptgs2 (rabbit, 1:200, Affinity, Cat# AF7003, RRID: AB_2835311), Gapdh (mouse, 1:200, Proteintech, Wuhan, China, Cat# 60004–1-Ig, RRID: AB_2107436) and neuronal nuclei (NeuN, mouse, 1:200, Proteintech, Cat# 66836–1-Ig, RRID: AB_2882179).

Techniques: Expressing, Quantitation Assay, In Vitro

Fig. 7. Site-directed mutagenesis on Alox15 reverses protective effects of alpha-tocopherol. (A-B) WB validation of Alox15 knockout. (C) Erastin IC50 for Alox15-KO cells after transfection with different plasmids. (D) 48 hours after transfection, cells were treated with 5 μM erastin for 12 hours, with or without treatment of alpha- tocopherol or liproxstatin-1. Cell viabilities were detected by cck-8 assays. (E) 48 hours after transfection, cells were treated with 5 μM erastin for 12 hours, with or without treatment of alpha-tocopherol or liproxstatin-1. Alox15, Ptgs2 and 4Hne expressions were detected by WB. (F-H) Quantitation of WB. (I) Lipid oxidation detected by C11-BODIPY (581/591) probe. Green indicates oxidized lipids and red indicates non-oxidized lipids. (J) Quantitation of C11. n = 3 for each group. Data are represented as the means ± SD. ns: no significance, ***p < 0.001.

Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie

Article Title: Alpha-tocopherol inhibits ferroptosis and promotes neural function recovery in rats with spinal cord injury via downregulating Alox15.

doi: 10.1016/j.biopha.2024.116734

Figure Lengend Snippet: Fig. 7. Site-directed mutagenesis on Alox15 reverses protective effects of alpha-tocopherol. (A-B) WB validation of Alox15 knockout. (C) Erastin IC50 for Alox15-KO cells after transfection with different plasmids. (D) 48 hours after transfection, cells were treated with 5 μM erastin for 12 hours, with or without treatment of alpha- tocopherol or liproxstatin-1. Cell viabilities were detected by cck-8 assays. (E) 48 hours after transfection, cells were treated with 5 μM erastin for 12 hours, with or without treatment of alpha-tocopherol or liproxstatin-1. Alox15, Ptgs2 and 4Hne expressions were detected by WB. (F-H) Quantitation of WB. (I) Lipid oxidation detected by C11-BODIPY (581/591) probe. Green indicates oxidized lipids and red indicates non-oxidized lipids. (J) Quantitation of C11. n = 3 for each group. Data are represented as the means ± SD. ns: no significance, ***p < 0.001.

Article Snippet: Slices were incubated overnight at 4°C with the primary antibodies against Alox15 (rabbit, 1:200, Affinity, Cat# DF13494, RRID: AB_2846513), Ptgs2 (rabbit, 1:200, Affinity, Cat# AF7003, RRID: AB_2835311), Gapdh (mouse, 1:200, Proteintech, Wuhan, China, Cat# 60004–1-Ig, RRID: AB_2107436) and neuronal nuclei (NeuN, mouse, 1:200, Proteintech, Cat# 66836–1-Ig, RRID: AB_2882179).

Techniques: Mutagenesis, Biomarker Discovery, Knock-Out, Transfection, CCK-8 Assay, Quantitation Assay

Fig. 5. Hyperlactylation of Ikzf1 at Lys164 is important for TH17 differentiation. (A) Radar diagram showing the top 15 DLPs in CD4+ T cells of EAU mice. (B) Enriched GO biological processes of up-regulated Kla proteins. (C and D) MS/MS spectra of the lactylated peptides of Ikzf1 at Lys164 and Lys373. (E) Immunoblot after immuno- precipitation (IP) assays showing increased lactylation of Ikzf1 in CD4+ T cells of EAU mice (n = 4 samples per group; **P < 0.01 by two-tailed unpaired Student’s t test). (F) Expression of Ikzf1 in CD4+ T cells of TH0 and TH17 groups measured through Western blotting (n = 4 samples per group; ns, no significance by two-tailed unpaired Student’s t test). (G) CD4+ T cells were transfected with the control virus (control), only sh-Ikzf1 (sh-Ikzf1), shIkzf1+oeWT-Ikzf1 (oeWT-Ikzf1), shIkzf1+oeK164R Ikzf1 (oeK164R-Ikzf1), and shIkzf1+oe K373R Ikzf1 (oeK373R-Ikzf1) adenovirus. Expression levels of Ikzf1 in different groups were measured through Western blotting (n = 4 samples per group; ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (H) FCM analysis of the frequency of TH17 cells in different groups as described in (G) (n = 4 samples per group; ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (I) Expression levels of IL-17 in the media of corresponding groups were tested by ELISA (n = 8 samples per group; **P < 0.01 and ***P < 0.001 by Kruskal-Wallis test). m/z, mass/charge ratio.

Journal: Science advances

Article Title: Global lactylome reveals lactylation-dependent mechanisms underlying T H 17 differentiation in experimental autoimmune uveitis.

doi: 10.1126/sciadv.adh4655

Figure Lengend Snippet: Fig. 5. Hyperlactylation of Ikzf1 at Lys164 is important for TH17 differentiation. (A) Radar diagram showing the top 15 DLPs in CD4+ T cells of EAU mice. (B) Enriched GO biological processes of up-regulated Kla proteins. (C and D) MS/MS spectra of the lactylated peptides of Ikzf1 at Lys164 and Lys373. (E) Immunoblot after immuno- precipitation (IP) assays showing increased lactylation of Ikzf1 in CD4+ T cells of EAU mice (n = 4 samples per group; **P < 0.01 by two-tailed unpaired Student’s t test). (F) Expression of Ikzf1 in CD4+ T cells of TH0 and TH17 groups measured through Western blotting (n = 4 samples per group; ns, no significance by two-tailed unpaired Student’s t test). (G) CD4+ T cells were transfected with the control virus (control), only sh-Ikzf1 (sh-Ikzf1), shIkzf1+oeWT-Ikzf1 (oeWT-Ikzf1), shIkzf1+oeK164R Ikzf1 (oeK164R-Ikzf1), and shIkzf1+oe K373R Ikzf1 (oeK373R-Ikzf1) adenovirus. Expression levels of Ikzf1 in different groups were measured through Western blotting (n = 4 samples per group; ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (H) FCM analysis of the frequency of TH17 cells in different groups as described in (G) (n = 4 samples per group; ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (I) Expression levels of IL-17 in the media of corresponding groups were tested by ELISA (n = 8 samples per group; **P < 0.01 and ***P < 0.001 by Kruskal-Wallis test). m/z, mass/charge ratio.

Article Snippet: The following primary antibodies were used: Pan-Kla (diluted 1:1000; PTM1401RM), Ikzf1-K164la (PTM), Ikzf1 (diluted 1:1000; 14859, CST), β-actin (diluted 1:3000; Proteintech, 20536-1-AP), and FLAG (diluted 1:1000; 14793, CST).

Techniques: Tandem Mass Spectroscopy, Western Blot, Immunoprecipitation, Two Tailed Test, Expressing, Transfection, Control, Virus, Enzyme-linked Immunosorbent Assay

Fig. 6. Ikzf1 K164la was up-regulated in CD4+ T cells of EAU mice. (A) Dot blot assays of Ikzf1-K164la antibody. (B) Ikzf1-K164la levels in TH0 and TH17 cells measured by Western blotting (n = 4 samples per group; **P < 0.01 by two-tailed unpaired Student’s t test). (C) Ikzf1-K164la levels in TH17 cells in response to DCA and rotenone treatment (n = 3 samples per group; *P < 0.05 by one-way ANOVA and Bonferroni post hoc test). (D) Ikzf1-K164la levels in CD4+ T cells of EAU mice at different time points (n = 4 samples per group; ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (E) Ikzf1-K164la levels in CD4+ T cells of EAU mice in response to DCA and rotenone treatment (n = 3 to 4 samples per group; *P < 0.05 by one-way ANOVA and Bonferroni post hoc test).

Journal: Science advances

Article Title: Global lactylome reveals lactylation-dependent mechanisms underlying T H 17 differentiation in experimental autoimmune uveitis.

doi: 10.1126/sciadv.adh4655

Figure Lengend Snippet: Fig. 6. Ikzf1 K164la was up-regulated in CD4+ T cells of EAU mice. (A) Dot blot assays of Ikzf1-K164la antibody. (B) Ikzf1-K164la levels in TH0 and TH17 cells measured by Western blotting (n = 4 samples per group; **P < 0.01 by two-tailed unpaired Student’s t test). (C) Ikzf1-K164la levels in TH17 cells in response to DCA and rotenone treatment (n = 3 samples per group; *P < 0.05 by one-way ANOVA and Bonferroni post hoc test). (D) Ikzf1-K164la levels in CD4+ T cells of EAU mice at different time points (n = 4 samples per group; ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (E) Ikzf1-K164la levels in CD4+ T cells of EAU mice in response to DCA and rotenone treatment (n = 3 to 4 samples per group; *P < 0.05 by one-way ANOVA and Bonferroni post hoc test).

Article Snippet: The following primary antibodies were used: Pan-Kla (diluted 1:1000; PTM1401RM), Ikzf1-K164la (PTM), Ikzf1 (diluted 1:1000; 14859, CST), β-actin (diluted 1:3000; Proteintech, 20536-1-AP), and FLAG (diluted 1:1000; 14793, CST).

Techniques: Dot Blot, Western Blot, Two Tailed Test

Fig. 7. CUT& Tag analysis reveals the transcriptional consequences of Ikzf1 under TH17 differentiation condition. (A) Binding density of WT Ikzf1 was visualized by deepTools. The heatmap presents the CUT& Tag counts on the different Ikzf1 binding peaks in CD4+ T cells between WT and K164R groups under TH17 induction con- dition, ordered by signal strength. (B) Genome-wide distribution of Ikzf1 binding peaks in CD4+ T cells of WT and K164R groups. (C) GO analysis of the decreased Ikzf1 binding peaks at candidate target genes. (D) Genome browser tracks of CUT& Tag signal at the representative target gene loci. (E) mRNA expression levels of IL-2, IL-4, Tlr4, and Runx1 measured using RT-qPCR (n = 4 samples per group; **P < 0.01 and ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (F) Luciferase activity of the IL-2 promoter–driven reporter vector was measured between the control, sh-Ikzf1, shIkzf1+oeWT-Ikzf1, shIkzf1+oeK164R-Ikzf1, and shIkzf1+oe K373R Ikzf1 groups (n = 8 samples per group; ***P < 0.001 by Kruskal-Wallis test). (G) Luciferase activity of the Runx1 promoter–driven reporter vector was measured between the control, sh-Ikzf1, shIkzf1+oeWT-Ikzf1, shIkzf1+oeK164R-Ikzf1, and shIkzf1+oe K373R Ikzf1 groups (n = 8 samples per group; ***P < 0.001 by one-way ANOVA and Dunnett’s T3 post hoc test). (H) FCM analysis of the frequency of TH17 cells in corresponding groups (n = 4 per group; ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (I) Ex- pression levels of IL-17 in the media of corresponding groups tested by ELISA (n = 8 per group; *P < 0.05 and ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). 50UTR, 50 untranslated region.

Journal: Science advances

Article Title: Global lactylome reveals lactylation-dependent mechanisms underlying T H 17 differentiation in experimental autoimmune uveitis.

doi: 10.1126/sciadv.adh4655

Figure Lengend Snippet: Fig. 7. CUT& Tag analysis reveals the transcriptional consequences of Ikzf1 under TH17 differentiation condition. (A) Binding density of WT Ikzf1 was visualized by deepTools. The heatmap presents the CUT& Tag counts on the different Ikzf1 binding peaks in CD4+ T cells between WT and K164R groups under TH17 induction con- dition, ordered by signal strength. (B) Genome-wide distribution of Ikzf1 binding peaks in CD4+ T cells of WT and K164R groups. (C) GO analysis of the decreased Ikzf1 binding peaks at candidate target genes. (D) Genome browser tracks of CUT& Tag signal at the representative target gene loci. (E) mRNA expression levels of IL-2, IL-4, Tlr4, and Runx1 measured using RT-qPCR (n = 4 samples per group; **P < 0.01 and ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (F) Luciferase activity of the IL-2 promoter–driven reporter vector was measured between the control, sh-Ikzf1, shIkzf1+oeWT-Ikzf1, shIkzf1+oeK164R-Ikzf1, and shIkzf1+oe K373R Ikzf1 groups (n = 8 samples per group; ***P < 0.001 by Kruskal-Wallis test). (G) Luciferase activity of the Runx1 promoter–driven reporter vector was measured between the control, sh-Ikzf1, shIkzf1+oeWT-Ikzf1, shIkzf1+oeK164R-Ikzf1, and shIkzf1+oe K373R Ikzf1 groups (n = 8 samples per group; ***P < 0.001 by one-way ANOVA and Dunnett’s T3 post hoc test). (H) FCM analysis of the frequency of TH17 cells in corresponding groups (n = 4 per group; ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). (I) Ex- pression levels of IL-17 in the media of corresponding groups tested by ELISA (n = 8 per group; *P < 0.05 and ***P < 0.001 by one-way ANOVA and Bonferroni post hoc test). 50UTR, 50 untranslated region.

Article Snippet: The following primary antibodies were used: Pan-Kla (diluted 1:1000; PTM1401RM), Ikzf1-K164la (PTM), Ikzf1 (diluted 1:1000; 14859, CST), β-actin (diluted 1:3000; Proteintech, 20536-1-AP), and FLAG (diluted 1:1000; 14793, CST).

Techniques: Binding Assay, Genome Wide, Expressing, Quantitative RT-PCR, Luciferase, Activity Assay, Plasmid Preparation, Control, Enzyme-linked Immunosorbent Assay

Fig. 8. Schematic diagram of the current study. Global lactylome reveals that Ikzf1 lactylation levels are up-regulated in the CD4+ T cells of EAU mice. Further exper- iments demonstrated that Ikzf1 K164 lactylation promotes TH17 differentiation by regulating IL-2, IL-4, Tlr4, and Runx1 expression.

Journal: Science advances

Article Title: Global lactylome reveals lactylation-dependent mechanisms underlying T H 17 differentiation in experimental autoimmune uveitis.

doi: 10.1126/sciadv.adh4655

Figure Lengend Snippet: Fig. 8. Schematic diagram of the current study. Global lactylome reveals that Ikzf1 lactylation levels are up-regulated in the CD4+ T cells of EAU mice. Further exper- iments demonstrated that Ikzf1 K164 lactylation promotes TH17 differentiation by regulating IL-2, IL-4, Tlr4, and Runx1 expression.

Article Snippet: The following primary antibodies were used: Pan-Kla (diluted 1:1000; PTM1401RM), Ikzf1-K164la (PTM), Ikzf1 (diluted 1:1000; 14859, CST), β-actin (diluted 1:3000; Proteintech, 20536-1-AP), and FLAG (diluted 1:1000; 14793, CST).

Techniques: Expressing

A Immunohistochemical staining of CD45 expression in colon lesions of Apc −/− versus Apc −/− ;Pkd1 −/− mice. Left—representative images, scale bars, 200 μm. Right—quantification. B Quantification of FITC-dextran levels in serum of dextran sodium sulfate (DSS)- or control water (Ctrl)-treated mice. C Representative H&E images of colon tissue from Pkd1 wt versus Pkd1 −/− mice treated with water or DSS. Scale bars, 100 μm. Measurements of mouse weight during treatment are located in Fig . D , E Representative images (left) and quantification (right) of expression of CLDN4 ( D ) and CLDN7 ( E ) in wt versus Pkd1 −/− colon epithelia. Scale bars 50 μm. F , G Representative images (left) and quantification (right) of CLDN4 and CLDN7 staining in organoids. Blue, DAPI; green, claudins. Scale bars 50 μm. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001 for all graphs.

Journal: Oncogenesis

Article Title: Loss of Pkd1 limits susceptibility to colitis and colorectal cancer

doi: 10.1038/s41389-023-00486-y

Figure Lengend Snippet: A Immunohistochemical staining of CD45 expression in colon lesions of Apc −/− versus Apc −/− ;Pkd1 −/− mice. Left—representative images, scale bars, 200 μm. Right—quantification. B Quantification of FITC-dextran levels in serum of dextran sodium sulfate (DSS)- or control water (Ctrl)-treated mice. C Representative H&E images of colon tissue from Pkd1 wt versus Pkd1 −/− mice treated with water or DSS. Scale bars, 100 μm. Measurements of mouse weight during treatment are located in Fig . D , E Representative images (left) and quantification (right) of expression of CLDN4 ( D ) and CLDN7 ( E ) in wt versus Pkd1 −/− colon epithelia. Scale bars 50 μm. F , G Representative images (left) and quantification (right) of CLDN4 and CLDN7 staining in organoids. Blue, DAPI; green, claudins. Scale bars 50 μm. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001 for all graphs.

Article Snippet: Immunofluorescence-IHC using antibodies to Ki-67 (1:100, #27309-I-AP, Proteintech, Rosemont, IL), β-Catenin (1:100, 2698S Cell Signaling, Beverly, MA), ph-S675-β-Catenin (1:70, 4176S Cell Signaling, Beverly, MA), alpha-smooth muscle actin (α-SMA, 1:300, A2547 Sigma-Aldrich, St. Louis, MO), Cldn4 and Cldn7 (1:50 and 1:200, respectively, #16195-I-AP and #10118-I-AP, Proteintech, Rosemont, IL) was used for FFPE tissue sections and organoids embedded in Matrigel using protocols as in [ , ].

Techniques: Immunohistochemical staining, Staining, Expressing, Control

(A) The CGG repeat is located within exon 1 of GIPC1 . Primers and probes for repeat-primed PCR (RP-PCR, green), fragment analysis (blue), and RNA fluorescence in situ hybridization (FISH, red) were designed within or adjacent to the repeat region. (B) The left panel shows the results for RP-PCR, in which abnormal CGG repeat expansions were detected in the upper three cases. The middle panel displays the results of fragment analysis. The right panel presents histograms of repeat sizes estimated from long-read sequencing data using NanoRepeat; orange bars indicate expanded alleles. (C) Histogram of CGG repeat sizes determined through fragment analysis. The lower graph shows an enlarged view of the low-frequency range. In the control group, most alleles contained 32 or fewer repeats. Two control samples exhibited abnormally expanded alleles, whereas four ALS samples harbored alleles with 33 or more repeats.

Journal: medRxiv

Article Title: GIPC1 intermediate-length repeat expansion in amyotrophic lateral sclerosis

doi: 10.1101/2025.05.22.25328088

Figure Lengend Snippet: (A) The CGG repeat is located within exon 1 of GIPC1 . Primers and probes for repeat-primed PCR (RP-PCR, green), fragment analysis (blue), and RNA fluorescence in situ hybridization (FISH, red) were designed within or adjacent to the repeat region. (B) The left panel shows the results for RP-PCR, in which abnormal CGG repeat expansions were detected in the upper three cases. The middle panel displays the results of fragment analysis. The right panel presents histograms of repeat sizes estimated from long-read sequencing data using NanoRepeat; orange bars indicate expanded alleles. (C) Histogram of CGG repeat sizes determined through fragment analysis. The lower graph shows an enlarged view of the low-frequency range. In the control group, most alleles contained 32 or fewer repeats. Two control samples exhibited abnormally expanded alleles, whereas four ALS samples harbored alleles with 33 or more repeats.

Article Snippet: GIPC1 immunostaining of spinal cord sections from patients with ALS (A) Anterior horn of the lumbar spinal cord from an ALS patient with a CGG repeat expansion stained with anti-GIPC1 antibody (Proteintech). (B) Anterior horn of the lumbar spinal cord from an ALS patient without a CGG repeat expansion stained with anti-GIPC1 antibody (Proteintech). (C) Anterior horn of the lumbar spinal cord from an ALS patient with a CGG repeat expansion stained with anti-GIPC1 antibody (Santa Cruz Biotechnology). (D) Anterior horn of the lumbar spinal cord from an ALS patient without a CGG repeat expansion stained with anti-GIPC1 antibody (Santa Cruz Biotechnology).

Techniques: Fluorescence, In Situ Hybridization, Sequencing, Control

(A) Results of RNA FISH using a (CGG) 8 probe. Intranuclear RNA foci were observed exclusively in the ALS patient harboring a CGG repeat expansion in GIPC1 . (B) RNA FISH results using another probe targeting the 5′ UTR of GIPC1 . Similar intranuclear RNA foci were detected with this GIPC1 -specific probe, confirming the presence of expanded repeat-containing RNA. Numbers in parentheses indicate the number of CGG repeats in GIPC1 . Scale bars: 5 μm.

Journal: medRxiv

Article Title: GIPC1 intermediate-length repeat expansion in amyotrophic lateral sclerosis

doi: 10.1101/2025.05.22.25328088

Figure Lengend Snippet: (A) Results of RNA FISH using a (CGG) 8 probe. Intranuclear RNA foci were observed exclusively in the ALS patient harboring a CGG repeat expansion in GIPC1 . (B) RNA FISH results using another probe targeting the 5′ UTR of GIPC1 . Similar intranuclear RNA foci were detected with this GIPC1 -specific probe, confirming the presence of expanded repeat-containing RNA. Numbers in parentheses indicate the number of CGG repeats in GIPC1 . Scale bars: 5 μm.

Article Snippet: GIPC1 immunostaining of spinal cord sections from patients with ALS (A) Anterior horn of the lumbar spinal cord from an ALS patient with a CGG repeat expansion stained with anti-GIPC1 antibody (Proteintech). (B) Anterior horn of the lumbar spinal cord from an ALS patient without a CGG repeat expansion stained with anti-GIPC1 antibody (Proteintech). (C) Anterior horn of the lumbar spinal cord from an ALS patient with a CGG repeat expansion stained with anti-GIPC1 antibody (Santa Cruz Biotechnology). (D) Anterior horn of the lumbar spinal cord from an ALS patient without a CGG repeat expansion stained with anti-GIPC1 antibody (Santa Cruz Biotechnology).

Techniques: